.. _index: Biodoop-BLAST ============= Biodoop-BLAST is a wrapper-based MapReduce implementation of BLAST for Hadoop. It is based on `Biodoop's core component `_, in turn based on the `Pydoop `_ API for `Hadoop `_. Installation: #. install `Biodoop core `_ #. get biodoop-blast from the `download page `_ #. unpack the biodoop-blast tarball, move to the distribution directory and run:: python setup.py install for a system-wide installation, or:: python setup.py install --user for a local installation Usage ----- Here is a quick usage example that can be run on a laptop: .. code-block:: bash $ start-all.sh $ hadoop dfsadmin -safemode wait $ wget ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/chromosomes/*random* $ zcat chr*.gz >genome $ formatdb -p F -o T -i genome $ tar cf genome.tar genome.* $ cat >query.fa >q1 ATCGCCTCTCCCGACCGAGCCTTCATGGGAGTCCCGCGGGAGCTGCTCCC >q2 TAGAAACTTGCTATTTCAAGTATTGTCATCACCTGGGATCTTGCTCGAAT $ biodoop_blast -o output.csv -p blastn -d genome query.fa genome.tar